Initiation and termination of transcription by bacteriophage T3 RNA polymerase

Abstract

Bacteriophage T3 RNA polymerase, a monomeric protein of Mr = 100,000, carries out highly specific initiation and termination of RNA synthesis from T3 DNA. Initiation of transcription occurs from several promoters that have been classified as classII and classIII on the basis of their location as well as function of the messages transcribed from them. Comparison of the sequences of the classIII promoters identified the following 23 basepair consensus sequence, including the transcription start (+1) site, that is recognized by T3 RNA polymerase:(UNFORMATTED TABLE OR EQUATION FOLLOWS){dollar}{dollar}\rm AATTAACCCTCACTAAAGGGAGA{dollar}{dollar}(TABLE/EQUATION ENDS).;While sequences of some of the classII promoters (those at 1.05 and 22.8 T3 map units) are remarkably similar to this consensus classIII promoter sequence, sequences of other classII promoters at 14.3, 15.1, 16.1 and 19.5 map units differed from it by having a C-G basepair instead of an A-T basepair at {dollar}-{dollar}1 position. In vitro rate of transcription from the classII promoter at 14.3 map units was considerably slower than the classIII promoters and the classII promoters at 1.05 and 22.8 map units. Conversion of the C-G basepair at {dollar}-{dollar}1 position of the promoter at 14.3 map units to an A-T basepair greatly increased the rate of transcription from it. Similarly, changing the A-T basepair at {dollar}-{dollar}1 position of the classII promoter at 1.05 map units to a C-G basepair decreased the rate of transcription from this promoter by 65%. These observations indicated that the residue at {dollar}-{dollar}1 position plays a critical role in determining the efficiency of promoter utilization by T3 RNA polymerase.;Termination of transcription by T3 RNA polymerase occurs at 59.7 mapunits at a rho-independent terminator involving a "stem and loop" structure, followed by a string of 6 uridine residues. However, this terminator is not very efficient--T3 RNA polymerase can read through this terminator, continuing transcription upto 100 map units, where it presumably falls off the linear end of T3 DNA.